Ask any question about EPFL courses, lectures, exercises, research, news, etc. or try the example questions below.
DISCLAIMER: The Graph Chatbot is not programmed to provide explicit or categorical answers to your questions. Rather, it transforms your questions into API requests that are distributed across the various IT services officially administered by EPFL. Its purpose is solely to collect and recommend relevant references to content that you can explore to help you answer your questions.
Microcapsules are appealing containers for delivering active ingredients, such as drugs and cosmetics, or conducting chemical and biological reactions on a small scale. To control the timing and location of release of these encapsulants, the shells of micr ...
The reaction of the anticancer compound (eta(6)-benzene)Ru(en)(OH2) (1) toward the nucleobases guanine, adenine, and cytosine is studied computationally using DFT/BP86 calculations. The aqua leaving group of such compounds is known to undergo ligand ...
Physically, the colour of an object is a complex result of its intrinsic surface properties, its transmission properties and its emission properties, all of which contribute to the mix of wavelengths in the light leaving the surface of the object. Structur ...
The replication of Moloney murine leukaemia virus relies on the formation of a stable homodimeric 'kissing complex' of a GACG tetraloop interacting through only two C center dot G base pairs flanked of 5'-adjacent Unpaired adenosines A9. Previous NMR inves ...
The temp. dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 ...
The present invention relates to methods of transferring a label from novel substrates to O-alkylguanine-DNA alkyltransferases (AGT) and O-alkylguanine-DNA alkyltransferase fusion proteins, and to novel substrates suitable in such methods. Proteins o ...
A review, with 17 refs. Methods for the regioselective introduction of alkoxymethyl-groups into the 2'-O-position of 5'-O-dimethoxytritylated, nucleobase-protected ribonucleosides and for the N-alkyloxycarbonylation of adenine and guanine nucleosides were ...
O6-substituted guanine derivs. are described for use as substrates for O6-alkylguanine-DNA alkyltransferases (AGT) that can be used to label the enzyme or fusion proteins contg. it. Proteins of interest are incorporated into an AGT fusion protein, the AGT ...
(Ecole Polytechnique Federale de Lausanne (EPFL), Switz.).2004
Guanine crystals are frequently encountered in nature in the beta-polymorph to create structural colors, to enhance the vision of creatures, and for camouflage. Unfortunately, it is challenging to control the crystallization of guanine in aqueous condition ...
Organometallic ruthenium(II)-arene complexes are currently attracting increasing interest as anticancer compds. with the potential to overcome drawbacks of traditional drugs like cisplatin with respect to resistance, selectivity, and toxicity. Rational des ...
