Concept

Guanine

Related publications (11)

Confinement-Controlled Crystallization of Guanine

Guanine crystals are frequently encountered in nature in the beta-polymorph to create structural colors, to enhance the vision of creatures, and for camouflage. Unfortunately, it is challenging to control the crystallization of guanine in aqueous condition ...

Amer Chemical Soc2024

Selectively permeable microcapsules

Chuen-Ru Li

Microcapsules are appealing containers for delivering active ingredients, such as drugs and cosmetics, or conducting chemical and biological reactions on a small scale. To control the timing and location of release of these encapsulants, the shells of micr ...

EPFL2023

Nanostructuring and lattice dynamics of materials by femtosecond lasers

Ahmad Odeh

Physically, the colour of an object is a complex result of its intrinsic surface properties, its transmission properties and its emission properties, all of which contribute to the mix of wavelengths in the light leaving the surface of the object. Structur ...

EPFL2013

Binding of Organometallic Ruthenium(II) Anticancer Compounds to Nucleobases: A Computational Study

Ursula Röthlisberger, Ivano Tavernelli, Christian Gossens

The reaction of the anticancer compound (eta(6)-benzene)Ru(en)(OH2) (1) toward the nucleobases guanine, adenine, and cytosine is studied computationally using DFT/BP86 calculations. The aqua leaving group of such compounds is known to undergo ligand ...

2009

Chemical approach for the study of the 'kissing complex' of Moloney murine leukaemia Virus

Sébastien Porcher

The replication of Moloney murine leukaemia virus relies on the formation of a stable homodimeric 'kissing complex' of a GACG tetraloop interacting through only two C center dot G base pairs flanked of 5'-adjacent Unpaired adenosines A9. Previous NMR inves ...

2008

Rational design of organo-ruthenium anticancer compounds

Ursula Röthlisberger, Ivano Tavernelli, Christian Gossens

Organometallic ruthenium(II)-arene complexes are currently attracting increasing interest as anticancer compds. with the potential to overcome drawbacks of traditional drugs like cisplatin with respect to resistance, selectivity, and toxicity. Rational des ...

2005

Guanine derivatives as substrates for O6-alkylguanine-DNA alkyltransferase and their use in labeling the enzyme and fusion proteins

Kai Johnsson

O6-substituted guanine derivs. are described for use as substrates for O6-alkylguanine-DNA alkyltransferases (AGT) that can be used to label the enzyme or fusion proteins contg. it. Proteins of interest are incorporated into an AGT fusion protein, the AGT ...

(Ecole Polytechnique Federale de Lausanne (EPFL), Switz.).2004

Substrates for o-alkylguanine-dna alkyltransferase

Kai Johnsson

The present invention relates to methods of transferring a label from novel substrates to O-alkylguanine-DNA alkyltransferases (AGT) and O-alkylguanine-DNA alkyltransferase fusion proteins, and to novel substrates suitable in such methods. Proteins o ...

2004

Temperature dependence of internucleotide nitrogen-nitrogen scalar couplings in RNA

Geoffrey Bodenhausen, Dominique Früh

The temp. dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 ...

2002

Protecting groups for the synthesis of ribonucleic acids

A review, with 17 refs. Methods for the regioselective introduction of alkoxymethyl-groups into the 2'-O-position of 5'-O-dimethoxytritylated, nucleobase-protected ribonucleosides and for the N-alkyloxycarbonylation of adenine and guanine nucleosides were ...

2001

Graph Chatbot

Chat with Graph Search

Ask any question about EPFL courses, lectures, exercises, research, news, etc. or try the example questions below.

DISCLAIMER: The Graph Chatbot is not programmed to provide explicit or categorical answers to your questions. Rather, it transforms your questions into API requests that are distributed across the various IT services officially administered by EPFL. Its purpose is solely to collect and recommend relevant references to content that you can explore to help you answer your questions.