This page is automatically generated and may contain information that is not correct, complete, up-to-date, or relevant to your search query. The same applies to every other page on this website. Please make sure to verify the information with EPFL's official sources.
Graph Chatbot
Chat with Graph Search
Ask any question about EPFL courses, lectures, exercises, research, news, etc. or try the example questions below.
DISCLAIMER: The Graph Chatbot is not programmed to provide explicit or categorical answers to your questions. Rather, it transforms your questions into API requests that are distributed across the various IT services officially administered by EPFL. Its purpose is solely to collect and recommend relevant references to content that you can explore to help you answer your questions.
Please note that this is not a complete list of this person’s publications. It includes only semantically relevant works. For a full list, please refer to Infoscience.
The temp. dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 ...
One-dimensional NOE expts. applicable to labeled macromols. are presented which allow the manipulation of specific spin diffusion pathways and thus unambiguously identify clandestine spins through which the direct NOE is mediated. A treatment of spin diffu ...