Posez n’importe quelle question sur les cours, conférences, exercices, recherches, actualités, etc. de l’EPFL ou essayez les exemples de questions ci-dessous.
AVERTISSEMENT : Le chatbot Graph n'est pas programmé pour fournir des réponses explicites ou catégoriques à vos questions. Il transforme plutôt vos questions en demandes API qui sont distribuées aux différents services informatiques officiellement administrés par l'EPFL. Son but est uniquement de collecter et de recommander des références pertinentes à des contenus que vous pouvez explorer pour vous aider à répondre à vos questions.
A no. of promising synthetic catalysts for the hydrolytic degrdn. of RNA have been developed in recent years. Some of them show remarkable selectivity for pyrimidine nucleotides. The general problem of all these studies is to distinguish between real effec ...
The bond lengths and dynamics of intra- and intermol. hydrogen bonds in an RNA kissing complex have been characterized by detg. the NMR relaxation rates of various double- and triple-quantum coherences that involve an imino proton and two neighboring nitro ...
Telomerase is a ribonucleoprotein enzyme that adds repetitive sequences to the ends of linear chromosomes, thereby counteracting nucleotide loss due to incomplete replication. A short region of the telomerase RNA subunit serves as template for nucleotide a ...
The bond lengths and dynamics of intra- and intermol. hydrogen bonds in an RNA kissing complex have been characterized by detg. the NMR relaxation rates of various double- and triple-quantum coherences that involve an imino proton and two neighboring nitro ...
The reaction of d,l-5'-activated nucleotide of adenosine in the presence and absence of montmorillonite gave 60:40 and 96:4 ratios, resp. of the d,d- and l,l:d,l- and l,d-dimers. [on SciFinder (R)] ...
The temp. dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 ...
Two sets of cross-correlated relaxation rates involving chem. shift anisotropy and dipolar interactions have been measured in an RNA kissing complex. In one case, both the CSA and dipolar interaction tensors are located on the same nucleotide base and are ...
Methods for amplification and sequencing of at least one nucleic acid comprising the following steps: (1) forming at least one nucleic acid template comprising the nucleic acid(s) to be amplified or sequenced, wherein said nucleic acid(s) contains at the 5 ...
A review, with 17 refs. Methods for the regioselective introduction of alkoxymethyl-groups into the 2'-O-position of 5'-O-dimethoxytritylated, nucleobase-protected ribonucleosides and for the N-alkyloxycarbonylation of adenine and guanine nucleosides were ...
The prepn. and the pairing properties of the new 3'-deoxyribopyranose (4'->2')-oligonucleotide (= p-DNA) pairing system, based on 3'-deoxy-b-D-ribo-pyranose nucleosides is presented. D-Xylose was efficiently converted to the prefunctionalized 3-deoxyribopy ...
