Hierarchical and Parallel Processing of Modulation Spectrum for ASR applications
Graph Chatbot
Chattez avec Graph Search
Posez n’importe quelle question sur les cours, conférences, exercices, recherches, actualités, etc. de l’EPFL ou essayez les exemples de questions ci-dessous.
AVERTISSEMENT : Le chatbot Graph n'est pas programmé pour fournir des réponses explicites ou catégoriques à vos questions. Il transforme plutôt vos questions en demandes API qui sont distribuées aux différents services informatiques officiellement administrés par l'EPFL. Son but est uniquement de collecter et de recommander des références pertinentes à des contenus que vous pouvez explorer pour vous aider à répondre à vos questions.
In this paper, we present new dynamic features derived from the modulation spectrum of the cepstral traje ctories of the speech signal. Cepstral trajectories are projected over the basis of sines and cosines yie lding the cepstral modulation frequency resp ...
In this paper, we present new dynamic features derived from the modulation spectrum of the cepstral traje ctories of the speech signal. Cepstral trajectories are projected over the basis of sines and cosines yie lding the cepstral modulation frequency resp ...
OFDM is a widely recognized and standardized modulation scheme for future high bit rate communications. Implementation of OFDM-based systems suffers from inphase-quadrature phase (IQ) imbalances in the front-end analog processing. The IQ imbalances can sev ...
The structure of a crystal of Sr0.61Ba0.39Nb2O6 has been solved and refined as an incommensurate structure in five-dimensional superspace. The structure is tetragonal, superspace group P4bm(pp1/2; p-p1/2), unit-cell parameters a = 12.4566 (9), c = 7.8698 ( ...
In this paper, we introduce new dynamic speech features based on the modulation spectrum. These features, termed Mel-cepstrum Modulation Spectrum (MCMS), map the time trajectories of the spectral dynamics into a series of slow and fast moving orthogonal co ...
In this paper, we introduce new dynamic speech features based on the modulation spectrum. These features, termed Mel-cepstrum Modulation Spectrum (MCMS), map the time trajectories of the spectral dynamics into a series of slow and fast moving orthogonal co ...
The temp. dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 ...
A novel NMR expt. allows one to characterize slow motion in macromols. The method exploits the fact that motions, such as rotation about dihedral angles, induce correlated fluctuations of the isotropic chem. shifts of the nuclei in the vicinity. The relaxa ...
We present a theoretical framework for the use of continuously phase modulated radio-frequency pulses for homonuclear decoupling in solid-state NMR. Within this framework, we have derived new families of decoupling sequences using numerical optimization. O ...
This thesis gives an overview of my work over the last four years on the development of analogue electronic building blocks for the auditory pathway, and their application to some models of processing in the auditory brainstem. The anatomy and physiology o ...