Ask any question about EPFL courses, lectures, exercises, research, news, etc. or try the example questions below.
DISCLAIMER: The Graph Chatbot is not programmed to provide explicit or categorical answers to your questions. Rather, it transforms your questions into API requests that are distributed across the various IT services officially administered by EPFL. Its purpose is solely to collect and recommend relevant references to content that you can explore to help you answer your questions.
In this Letter we present a framework for the use of continuously phase modulated radio-frequency pulses for heteronuclear decoupling in NMR of Liquid Crystals. Within this framework, we found new sets of heteronuclear decoupling sequences using numerical ...
The purpose of this note is to highlight some of the unique properties of spline wavelets. These wavelets can be classified in four categories: othogonal (Battle-Lemarié), semi-orthogonal (e.g., B-spline), shift-orthogonal, and biorthogonal (Cohen-Daubechi ...
The temp. dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 ...
A new expt. allows the identification of residues that feature slow conformational exchange in macromols. Rotations about dihedral angles that are slower than the global correlation time tc cause a modulation of the isotropic chem. shifts of the nuclei. If ...
A heterodyne laser Doppler interferometer operating up to 100 MHz with an optical vibration excitation function was implemented to enable frequency detection of nanocantilevers. By using the stimulant of a network analyzer to sweep the modulation frequency ...
A novel NMR expt. allows one to characterize slow motion in macromols. The method exploits the fact that motions, such as rotation about dihedral angles, induce correlated fluctuations of the isotropic chem. shifts of the nuclei in the vicinity. The relaxa ...
We present a theoretical framework for the use of continuously phase modulated radio-frequency pulses for homonuclear decoupling in solid-state NMR. Within this framework, we have derived new families of decoupling sequences using numerical optimization. O ...
New radio-frequency pulse envelopes are presented for selective inversion and in-phase excitation in NMR. The envelope functions consist of superpositions of three or four time-shifted Gaussians with optimized widths and peak amplitudes. The offset depende ...
A novel NMR method characterizes slow motions in proteins by multiple refocusing of double- and zero-quantum coherences of amide protons and nitrogen-15 nuclei. If both nuclei experience changes in their isotropic chem. shifts because of internal motions o ...
