Uracil | EPFL Graph Search

Are you an EPFL student looking for a semester project?

Work with us on data science and visualisation projects, and deploy your project as an app on top of GraphSearch.

Uracil (ˈjʊərəsɪl) (symbol U or Ura) is one of the four nucleobases in the nucleic acid RNA. The others are adenine (A), cytosine (C), and guanine (G). In RNA, uracil binds to adenine via two hydrogen bonds. In DNA, the uracil nucleobase is replaced by thymine (T). Uracil is a demethylated form of thymine. Uracil is a common and naturally occurring pyrimidine derivative. The name "uracil" was coined in 1885 by the German chemist Robert Behrend, who was attempting to synthesize derivatives of uric acid. Originally discovered in 1900 by Alberto Ascoli, it was isolated by hydrolysis of yeast nuclein; it was also found in bovine thymus and spleen, herring sperm, and wheat germ. It is a planar, unsaturated compound that has the ability to absorb light. Uracil that was formed extraterrestrially has been detected in the Murchison meteorite, in a near-Earth asteroid, and possibly on the surface of the mo

About this result

This page is automatically generated and may contain information that is not correct, complete, up-to-date, or relevant to your search query. The same applies to every other page on this website. Please make sure to verify the information with EPFL's official sources.

Related publications (7)

Related publications

Related people (1)

Related people

Related units (2)

Related units

Related concepts

No results

Related concepts

Related courses (12)

Related courses

Related lectures (17)

Related lectures

BIO-105: Cellular biology and biochemistry for engineers

Basic course in biochemistry as well as cellular and molecular biology for non-life science students enrolling at the Master or PhD thesis level from various engineering disciplines. It reviews essential notions necessary for a training in biology-related engineering fields.

BIO-373: Genetics and genomics

The theoretical part of this course covers classical genetics and contemporary genomics. Because bioinformatics has become important for genomic research, the course also includes practical applications to genomic analyses using Python, including group projects.

BIO-471: Cancer biology I

The course covers in detail molecular mechanisms of cancer development with emphasis on cell cycle control, genome stability, oncogenes and tumor suppressor genes.

, ,

1994

A multi-scale time-resolved study of photoactivated dynamics in 5-benzyl uracil, a model for DNA/protein interactions

Majed Chergui, Enrico Pomarico, Mohammadhassan Valadan

We combine fluorescence up-conversion and time correlated single photon counting experiments to investigate the 5-benzyl uracil excited state dynamics in methanol from 100 fs up to several ns. This molecule has been proposed as a model for DNA/protein interactions. Our results show emission bands at about 310 and 350 nm that exhibit bi-exponential sub-ps decays. Calculations, including solvent effects by a mixed discrete-continuum model, indicate that the Franck Condon region is characterized by significant coupling between the excited states of the benzyl and the uracil moieties, mirrored by the short-lived emission at 310 nm. Two main ground state recovery pathways are identified, both contributing to the 350 nm emission. The first ‘photophysical’ decay path involves a ππ* excited state localized on the uracil and is connected to the ground electronic state by an easily accessible crossing with S0, accounting for the short lifetime component. Simulations indicate that a possible second pathway is characterized by exciplex formation, with partial benzene → uracil charge transfer character, that may lead instead to photocyclization. The relevance of our results is discussed in view of the photoactivated dynamics of DNA/protein complexes, with implications on their interaction mechanisms.

2019

Temperature dependence of internucleotide nitrogen-nitrogen scalar couplings in RNA

Geoffrey Bodenhausen, Dominique Früh

The temp. dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 K. The value of 2hJ(N,N) was obsd. to decrease monotonically for all four base pairs with increasing temp. The temp. dependence of 2hJ(N,N) was found to be more pronounced for the A-U base pair than for G-C base pairs. An earlier study of cross-correlation effects at 296 K appeared to indicate a reduced mobility of the A-U base pair, as evidenced by small contributions of chem. shift modulation to relaxation rates. [on SciFinder (R)]

2002