Concept

Cytosine

Related publications (9)

Relief of ParB autoinhibition by parS DNA catalysis and recycling of ParB by CTP hydrolysis promote bacterial centromere assembly

Three-component ParABS systems are widely distributed factors for plasmid partitioning and chromosome segregation in bacteria. ParB acts as adaptor protein between the 16-base pair centromeric parS DNA sequences and the DNA segregation proteins ParA and Sm ...

AMER ASSOC ADVANCEMENT SCIENCE2021

Diiron Complexes with a Bridging Functionalized Allylidene Ligand: Synthesis, Structural Aspects, and Cytotoxicity

Paul Joseph Dyson, Lucinda Kate Batchelor, Silvia Schoch

Regio- and stereoselective nucleophilic attack of cyanide (from NBu4CN) to cationic diiron vinyliminium compounds [Fe2Cp2(CO)(mu-CO){mu-eta(1):eta(3)-C-(R')C(R '')-CNMe2}]CF3SO3 ([1a-f]CF3SO3) affords the nitrile-aminoallylidene derivatives 2a-f in good to ...

AMER CHEMICAL SOC2020

Self-organization of parS centromeres by the ParB CTP hydrolase

Paolo De Los Rios, Stefano Zamuner

ParABS systems facilitate chromosome segregation and plasmid partitioning in bacteria and archaea. ParB protein binds centromeric parS DNA sequences and spreads to flanking DNA. We show that ParB is an enzyme that hydrolyzes cytidine triphosphate (CTP) to ...

2019

Biosensor based on chemically-designed anchorable cytochrome c for the detection of H2O2 released by aquaticcells

Olivier Martin, Christian Santschi, Guillaume Suarez

A novel third generation biosensor was developed based on one-shot adsorption of chemically-modified cytochrome c (cyt c) onto bare gold electrodes. In contrast to the classic approach which consists of attaching cyt c onto an active self-assembled monolay ...

Elsevier2013

Synthesis, characterization, DNA interaction and potential applications of gold nanoparticles functionalized with Acridine Orange fluorophores

Alberto Schena

Two new water-soluble gold nanoparticles (AO-TEG-Au and AO-PEG-Au NPs) are prepared and characterized. They are stabilized by thioalkylated oligoethylene glycols and functionalized with fluorescent Acridine Orange (AO) derivatives. Despite the different co ...

2011

Model Structure of Human APOBEC3G

Didier Trono, Bastien Mangeat, Amalio Telenti, Olivier Michielin

BACKGROUND: APOBEC3G (apolipoprotein B mRNA-editing enzyme, catalytic polypeptide-like 3G) has antiretroviral activity associated with the hypermutation of viral DNA through cytosine deamination. APOBEC3G has two cytosine deaminase (CDA) domains; the catal ...

Public Library of Science2007

Optimized methods for the enzymatic ligation of oligoribonucleotides and analogues

Frédéric David Meylan

The preparation of oligoribonucleotides is of great interest for structural and functional investigations in biomolecular chemistry and biology. Relevant RNAs are relatively long and contain often modifications. Two methods for their preparation are curren ...

EPFL2006

Spontaneous condensation in DNA-polystyrene-b-poly(L-lysine) polyelectrolyte block copolymer mixtures

Harm-Anton Klok

We investigated the condensation of calf thymus DNA by amphiphilic polystyrenem-b-poly(l-lysine)n block copolymers ( PS m -b- PLys n , m, n = degree of polymerization), using small-angle X-ray scattering, polarized optical microscopy and laser scanning con ...

2006

Temperature dependence of internucleotide nitrogen-nitrogen scalar couplings in RNA

Geoffrey Bodenhausen, Dominique Früh

The temp. dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 ...

2002

Graph Chatbot

Chat with Graph Search

Ask any question about EPFL courses, lectures, exercises, research, news, etc. or try the example questions below.

DISCLAIMER: The Graph Chatbot is not programmed to provide explicit or categorical answers to your questions. Rather, it transforms your questions into API requests that are distributed across the various IT services officially administered by EPFL. Its purpose is solely to collect and recommend relevant references to content that you can explore to help you answer your questions.