Ask any question about EPFL courses, lectures, exercises, research, news, etc. or try the example questions below.
DISCLAIMER: The Graph Chatbot is not programmed to provide explicit or categorical answers to your questions. Rather, it transforms your questions into API requests that are distributed across the various IT services officially administered by EPFL. Its purpose is solely to collect and recommend relevant references to content that you can explore to help you answer your questions.
Publish/subscribe (pub/sub) is considered a valuable middleware architecture that proliferates loose coupling and leverages reconfigurability and evolution. Up to now, existing pub/sub middleware was optimized for static systems where users as well as the ...
Last Encounter Routing (LER) algorithms for mobile ad hoc networks rely only on encounter histories at every node to route packets, and therefore do not need control traffic to track topology changes due to node mobility. LER exploits the fact that past in ...
The temp. dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 ...
We investigate the role of carrier mobility in holographic recording in LiNbO3 crystals. Both normal holographic recording (single wavelength, single trap) and two-center recording are considered, and the differences between the performances of the two met ...
Optical motion capture provides an impressive ability to replicate gestures. However, even with a highly professional system there are many instances where crucial markers are occluded or when the algorithm confuses the trajectory of one marker with that o ...
A new solid-state NMR experiment, J-WISE, is presented for studying local mobility in solids with atomic resolution. The experiment correlates the wide-line proton spectrum with the isotropic chemical shift of carbon-13 via the J coupling between both nucl ...
The effect of hydration on the mobility of polysaccharides in onion cell-wall material (CWM) was studied by solid-state NMR. The application of proton T-1 rho, carbon T-1 relaxation measurements, and 2D-WISE (wideline separation) experiments led to a coher ...
In this work, we present a correlation between the morphological characterization of InyAl1−yAs/InxGa1−xAsheterostructures grown on InP substrates for high electron mobility transistors(HEMTs) applications as determined by transmission electron microscopy, ...
In this study we used transmission electron microscopy (TEM) to assess the origin of the electrical behaviour of two dimensional electron gas (2DEG) in high electron mobility transistors (HEMTs) based upon InAlAs/InGaAs heterostructures grown on InP substr ...
We consider the problem of multicast routing in a large single domain network with a very large number of multicast groups with small number of receivers. Such a case occurs, for example, when multicast addresses are statically allocated to mobile terminal ...