Dynamic nuclear polarization by frequency modulation of a tunable gyrotron of 260 GHz
Graph Chatbot
Chat with Graph Search
Ask any question about EPFL courses, lectures, exercises, research, news, etc. or try the example questions below.
DISCLAIMER: The Graph Chatbot is not programmed to provide explicit or categorical answers to your questions. Rather, it transforms your questions into API requests that are distributed across the various IT services officially administered by EPFL. Its purpose is solely to collect and recommend relevant references to content that you can explore to help you answer your questions.
In this paper, we present new dynamic features derived from the modulation spectrum of the cepstral traje ctories of the speech signal. Cepstral trajectories are projected over the basis of sines and cosines yie lding the cepstral modulation frequency resp ...
In this paper, we present new dynamic features derived from the modulation spectrum of the cepstral traje ctories of the speech signal. Cepstral trajectories are projected over the basis of sines and cosines yie lding the cepstral modulation frequency resp ...
Infrared spectroscopy using semiconductor lasers is a promising technique for trace gas detection. It allows a continuous and real time monitoring of several species, with a high sensitivity and a good selectivity. Among all the possible methods two are pa ...
We present a theoretical framework for the use of continuously phase modulated radio-frequency pulses for homonuclear decoupling in solid-state NMR. Within this framework, we have derived new families of decoupling sequences using numerical optimization. O ...
Two novel schemes are described for cross polarization in NMR that make it possible to achieve an efficient transfer of polarization from abundant I spins to dil. S spins under high-speed magic angle spinning spectroscopy, which is useful for systems with ...
In this Letter we present a framework for the use of continuously phase modulated radio-frequency pulses for heteronuclear decoupling in NMR of Liquid Crystals. Within this framework, we found new sets of heteronuclear decoupling sequences using numerical ...
A heterodyne laser Doppler interferometer operating up to 100 MHz with an optical vibration excitation function was implemented to enable frequency detection of nanocantilevers. By using the stimulant of a network analyzer to sweep the modulation frequency ...
The structure of a crystal of natural melilite from San Venanzo, Umbria (Italy) of the general formula X(2)T1(T2)(2)O-7, where X = Ca0.945Sr0.005Na0.04K0.01, T1 = Mg0.92Al0.08 and T2 = Si0.99Al0.01, has been solved and refined as an incommensurate structur ...
The temp. dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 ...
A novel NMR expt. allows one to characterize slow motion in macromols. The method exploits the fact that motions, such as rotation about dihedral angles, induce correlated fluctuations of the isotropic chem. shifts of the nuclei in the vicinity. The relaxa ...
