Mel-Cepstrum Modulation Spectrum (MCMS) Features for Robust ASR
Graph Chatbot
Chat with Graph Search
Ask any question about EPFL courses, lectures, exercises, research, news, etc. or try the example questions below.
DISCLAIMER: The Graph Chatbot is not programmed to provide explicit or categorical answers to your questions. Rather, it transforms your questions into API requests that are distributed across the various IT services officially administered by EPFL. Its purpose is solely to collect and recommend relevant references to content that you can explore to help you answer your questions.
A heterodyne laser Doppler interferometer operating up to 100 MHz with an optical vibration excitation function was implemented to enable frequency detection of nanocantilevers. By using the stimulant of a network analyzer to sweep the modulation frequency ...
In this paper, we introduce new dynamic speech features based on the modulation spectrum. These features, termed Mel-cepstrum Modulation Spectrum (MCMS), map the time trajectories of the spectral dynamics into a series of slow and fast moving orthogonal co ...
A novel demodulation technique for performing dynamic deformation measurements using a path-unbalanced Michelson interferometer is reported, The method is based on the rf amplitude modulation of a low-coherence source, and demodulation Is achieved by track ...
A novel NMR expt. allows one to characterize slow motion in macromols. The method exploits the fact that motions, such as rotation about dihedral angles, induce correlated fluctuations of the isotropic chem. shifts of the nuclei in the vicinity. The relaxa ...
The temp. dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 ...
The paper presents a work-in-progress on several emerging concepts in Automatic Speech Recognition (ASR), that are being currently studied at IDIAP. This work can be roughly categorized into three categories: 1) data-guided features, 2) features based on m ...
The structure of a crystal of Sr0.61Ba0.39Nb2O6 has been solved and refined as an incommensurate structure in five-dimensional superspace. The structure is tetragonal, superspace group P4bm(pp1/2; p-p1/2), unit-cell parameters a = 12.4566 (9), c = 7.8698 ( ...
In this paper, we introduce new dynamic speech features based on the modulation spectrum. These features, termed Mel-cepstrum Modulation Spectrum (MCMS), map the time trajectories of the spectral dynamics into a series of slow and fast moving orthogonal co ...
This thesis gives an overview of my work over the last four years on the development of analogue electronic building blocks for the auditory pathway, and their application to some models of processing in the auditory brainstem. The anatomy and physiology o ...
The structure of a crystal of natural melilite from San Venanzo, Umbria (Italy) of the general formula X(2)T1(T2)(2)O-7, where X = Ca0.945Sr0.005Na0.04K0.01, T1 = Mg0.92Al0.08 and T2 = Si0.99Al0.01, has been solved and refined as an incommensurate structur ...