Posez n’importe quelle question sur les cours, conférences, exercices, recherches, actualités, etc. de l’EPFL ou essayez les exemples de questions ci-dessous.
AVERTISSEMENT : Le chatbot Graph n'est pas programmé pour fournir des réponses explicites ou catégoriques à vos questions. Il transforme plutôt vos questions en demandes API qui sont distribuées aux différents services informatiques officiellement administrés par l'EPFL. Son but est uniquement de collecter et de recommander des références pertinentes à des contenus que vous pouvez explorer pour vous aider à répondre à vos questions.
The right-end telomere of replicative form (RF) DNA of the autonomous parvovirus minute virus of mice (MVM) consists of a sequence that is self-complementary except for a three nucleotide loop around the axis of symmetry and an interior bulge of three unpa ...
Viral replication usually requires that innate intracellular lines of defence be overcome, a task usually accomplished by specialized viral gene products. The virion infectivity factor (Vif) protein of human immunodeficiency virus (HIV) is required during ...
Within this project methods for the preparation of the unnatural nucleic acids 3'-O-Methyl-pRNA and pDNA (3'-Desoxy-pRNA) were developed. The pairing properties of these two systems have been examined and compared with that of pRNA. All of the three system ...
The cytosine deaminase APOBEC3G, in the absence of the human immunodeficiency virus type 1 (HIV-1) accessory gene HIV-1 viral infectivity factor (vif), inhibits viral replication by introducing G-->A hypermutation in the newly synthesized HIV-1 DNA negativ ...
Telomerase extends chromosome ends by iterative reverse transcription of its RNA template. Following the addition of each telomeric repeat, the RNA template and the telomeric substrate reset their relative position in the active site provided by the telome ...
Cytosine methylation at CpG sites is often negatively correlated with mammalian gene activity. Many transcription factors whose DNA binding site contains one or more CpG dinucleotides are no longer able to efficiently bind DNA when the site is methylated. ...
DNA methyltransferase I (Dnmt1), the maintenance enzyme for DNA cytosine methylation, is expressed at high levels in the CNS during embryogenesis and after birth. Because embryos deficient for Dnmt1 die at gastrulation, the role of Dnmt1 in the development ...
We methylated specific cytosine residues within or immediately around the CTF and Sp1 binding sites of the Herpes simplex virus thymidine kinase promoter. The efficiency of transcription in vivo was reduced at least 50-fold compared with transcription from ...
The temp. dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 ...
