Determination of the vacuum optomechanical coupling rate using frequency noise calibration
Graph Chatbot
Chat with Graph Search
Ask any question about EPFL courses, lectures, exercises, research, news, etc. or try the example questions below.
DISCLAIMER: The Graph Chatbot is not programmed to provide explicit or categorical answers to your questions. Rather, it transforms your questions into API requests that are distributed across the various IT services officially administered by EPFL. Its purpose is solely to collect and recommend relevant references to content that you can explore to help you answer your questions.
Frequency shift, design, and fabrication issues have been investigated for the realization of 8 GHz handpass filters based on AlN thin film bulk acoustic wave resonators. Fabrication includes well-textured AlN thin films on Pt (111) electrodes and SiO2/AlN ...
An experimental method is presented for characterization of the combined intensity and frequency modulation produced when the injection current of a laser diode is modulated. The reported technique is based on the analysis of the harmonic signals produced ...
Infrared spectroscopy using semiconductor lasers is a promising technique for trace gas detection. It allows a continuous and real time monitoring of several species, with a high sensitivity and a good selectivity. Among all the possible methods two are pa ...
The temp. dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 ...
A heterodyne laser Doppler interferometer operating up to 100 MHz with an optical vibration excitation function was implemented to enable frequency detection of nanocantilevers. By using the stimulant of a network analyzer to sweep the modulation frequency ...
The recent advances made in MEMS and particularly in RF MEMS technology are enabling new architectures for the integration of RF transceivers with improved performance and smaller size. Several fundamental building blocks benefit from the availability of h ...
The modulation spectrum is an efficient representation for describing dynamic information in signals. In this work we investigate how to exploit different elements of the modulation spectrum for extraction of information in automatic recognition of speech ...
Neoclassical tearing modes are driven by the reduction of bootstrap current inside the island due to the flattening of the pressure profile. This current perturbation enhances the magnetic perturbation responsible for the island formation. Therefore it is ...
In this paper, we present new dynamic features derived from the modulation spectrum of the cepstral traje ctories of the speech signal. Cepstral trajectories are projected over the basis of sines and cosines yie lding the cepstral modulation frequency resp ...
In this paper, we present new dynamic features derived from the modulation spectrum of the cepstral traje ctories of the speech signal. Cepstral trajectories are projected over the basis of sines and cosines yie lding the cepstral modulation frequency resp ...
