Publications related to Multi-Tone Signaling and ADC-Based Digital Receiver for High-Speed Wireline Serial Links

Adaptive MIMO OFDM Receivers: Implementation Impairments and Complexity Issues

MIMO OFDM communications is a promising choice for future high data rate wireless systems. However, the commercial deployment of MIMO OFDM systems faces some challenges, including those arising from front-end analog implementation impairments and complex ...

2004

Simple Topology for Low-Voltage and Low-Power RF Quadrature Oscillators

Christian Enz, Uroschanit Yodprasit

A design technique for implementing a low-voltage and low-power quadrature oscillator operating at radio frequencies is proposed. The oscillator utilises a cascade of four stages of capacitive-source amplifiers to generate balanced quadrature signals. The ...

2004

Mel-Cepstrum Modulation Spectrum (MCMS) Features for Robust ASR

Hervé Bourlard, Hemant Misra, Vivek Tyagi

In this paper, we present new dynamic features derived from the modulation spectrum of the cepstral traje ctories of the speech signal. Cepstral trajectories are projected over the basis of sines and cosines yie lding the cepstral modulation frequency resp ...

IDIAP2003

Mel-Cepstrum Modulation Spectrum (MCMS) Features for Robust ASR

Hervé Bourlard, Hemant Misra, Vivek Tyagi

In this paper, we present new dynamic features derived from the modulation spectrum of the cepstral traje ctories of the speech signal. Cepstral trajectories are projected over the basis of sines and cosines yie lding the cepstral modulation frequency resp ...

2003

Measurement of dynamic deformations using a path unbalance Michelson interferometer based optical fiber sensing device

Luc Thévenaz, Pramod Rastogi

A novel demodulation technique for performing dynamic deformation measurements using a path-unbalanced Michelson interferometer is reported, The method is based on the rf amplitude modulation of a low-coherence source, and demodulation Is achieved by track ...

2003

On Factorizing Spectral Dynamics for Robust Speech Recognition

Hervé Bourlard, Hemant Misra, Vivek Tyagi

In this paper, we introduce new dynamic speech features based on the modulation spectrum. These features, termed Mel-cepstrum Modulation Spectrum (MCMS), map the time trajectories of the spectral dynamics into a series of slow and fast moving orthogonal co ...

IDIAP2003

On Factorizing Spectral Dynamics for Robust Speech Recognition

Hervé Bourlard, Hemant Misra, Vivek Tyagi

In this paper, we introduce new dynamic speech features based on the modulation spectrum. These features, termed Mel-cepstrum Modulation Spectrum (MCMS), map the time trajectories of the spectral dynamics into a series of slow and fast moving orthogonal co ...

2003

Bandwidth-Efficient Constant-Energy Trellis-Coded Modulation Schemes with Prescribed Decoding Delay

Bixio Rimoldi

For a general class of constant-energy trellis-coded modulation schemes with

2^{\nu}

states, necessary and sufficient conditions to guarantee that a maximum-likelihood sequence estimator can decode each symbol with a fixed delay of

\nu

symbols are deri ...

2002

Temperature dependence of internucleotide nitrogen-nitrogen scalar couplings in RNA

Geoffrey Bodenhausen, Dominique Früh

The temp. dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 ...

2002

Multi-input multi-output fading channel tracking and equalization using Kalman estimation

Ali H. Sayed, Christina Fragouli

This paper addresses the problem of channel tracking and equalization for multi-input multi-output (MIMO) time-varying frequency-selective channels. These channels model the effects of inter-symbol interference (ISI), co-channel interference (CCI), and noi ...

Institute of Electrical and Electronics Engineers2002

Multi-Tone Signaling and ADC-Based Digital Receiver for High-Speed Wireline Serial Links

Graph Chatbot

Chat with Graph Search

Adaptive MIMO OFDM Receivers: Implementation Impairments and Complexity Issues

Simple Topology for Low-Voltage and Low-Power RF Quadrature Oscillators

Mel-Cepstrum Modulation Spectrum (MCMS) Features for Robust ASR

Mel-Cepstrum Modulation Spectrum (MCMS) Features for Robust ASR

Measurement of dynamic deformations using a path unbalance Michelson interferometer based optical fiber sensing device

On Factorizing Spectral Dynamics for Robust Speech Recognition

On Factorizing Spectral Dynamics for Robust Speech Recognition

Bandwidth-Efficient Constant-Energy Trellis-Coded Modulation Schemes with Prescribed Decoding Delay

Temperature dependence of internucleotide nitrogen-nitrogen scalar couplings in RNA

Multi-input multi-output fading channel tracking and equalization using Kalman estimation

Mel-Cepstrum Modulation Spectrum (MCMS) Features for Robust ASR

Measurement of dynamic deformations using a path unbalance Michelson interferometer based optical fiber sensing device

Simple Topology for Low-Voltage and Low-Power RF Quadrature Oscillators

Mel-Cepstrum Modulation Spectrum (MCMS) Features for Robust ASR

Bandwidth-Efficient Constant-Energy Trellis-Coded Modulation Schemes with Prescribed Decoding Delay

Adaptive MIMO OFDM Receivers: Implementation Impairments and Complexity Issues

On Factorizing Spectral Dynamics for Robust Speech Recognition

On Factorizing Spectral Dynamics for Robust Speech Recognition

Temperature dependence of internucleotide nitrogen-nitrogen scalar couplings in RNA

Multi-input multi-output fading channel tracking and equalization using Kalman estimation