Cross-correlated chemical shift modulation: A signature of slow internal motions in proteins
Related publications (44)
Graph Chatbot
Chat with Graph Search
Ask any question about EPFL courses, lectures, exercises, research, news, etc. or try the example questions below.
DISCLAIMER: The Graph Chatbot is not programmed to provide explicit or categorical answers to your questions. Rather, it transforms your questions into API requests that are distributed across the various IT services officially administered by EPFL. Its purpose is solely to collect and recommend relevant references to content that you can explore to help you answer your questions.
An experimental method is presented for characterization of the combined intensity and frequency modulation produced when the injection current of a laser diode is modulated. The reported technique is based on the analysis of the harmonic signals produced ...
The temp. dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 ...
A novel NMR method characterizes slow motions in proteins by multiple refocusing of double- and zero-quantum coherences of amide protons and nitrogen-15 nuclei. If both nuclei experience changes in their isotropic chem. shifts because of internal motions o ...
We present a theoretical framework for the use of continuously phase modulated radio-frequency pulses for homonuclear decoupling in solid-state NMR. Within this framework, we have derived new families of decoupling sequences using numerical optimization. O ...
A new expt. allows the identification of residues that feature slow conformational exchange in macromols. Rotations about dihedral angles that are slower than the global correlation time tc cause a modulation of the isotropic chem. shifts of the nuclei. If ...
In this paper, we present new dynamic features derived from the modulation spectrum of the cepstral traje ctories of the speech signal. Cepstral trajectories are projected over the basis of sines and cosines yie lding the cepstral modulation frequency resp ...
A novel demodulation technique for performing dynamic deformation measurements using a path-unbalanced Michelson interferometer is reported, The method is based on the rf amplitude modulation of a low-coherence source, and demodulation Is achieved by track ...
An all-fiber phase modulator based on lead titanate zirconate coating deposited by dc reactive magnetron sputtering was fabricated and optically characterized. The frequency response showed a flat broadband structure up to 600 kHz, with an efficiency of 0. ...
In this paper, we present new dynamic features derived from the modulation spectrum of the cepstral traje ctories of the speech signal. Cepstral trajectories are projected over the basis of sines and cosines yie lding the cepstral modulation frequency resp ...
In the first part of the paper, also in this issue of the JOURNAL, the design of the frequency synthesizer and receiver section of an FSK transceiver was described. It operates in the 434-MHz ISM (Industrial, Scientific, Medical) band and is realized in a ...