Cross-correlated chemical shift modulation: A signature of slow internal motions in proteins
Publications associées (44)
Graph Chatbot
Chattez avec Graph Search
Posez n’importe quelle question sur les cours, conférences, exercices, recherches, actualités, etc. de l’EPFL ou essayez les exemples de questions ci-dessous.
AVERTISSEMENT : Le chatbot Graph n'est pas programmé pour fournir des réponses explicites ou catégoriques à vos questions. Il transforme plutôt vos questions en demandes API qui sont distribuées aux différents services informatiques officiellement administrés par l'EPFL. Son but est uniquement de collecter et de recommander des références pertinentes à des contenus que vous pouvez explorer pour vous aider à répondre à vos questions.
An experimental method is presented for characterization of the combined intensity and frequency modulation produced when the injection current of a laser diode is modulated. The reported technique is based on the analysis of the harmonic signals produced ...
A novel NMR method characterizes slow motions in proteins by multiple refocusing of double- and zero-quantum coherences of amide protons and nitrogen-15 nuclei. If both nuclei experience changes in their isotropic chem. shifts because of internal motions o ...
A new expt. allows the identification of residues that feature slow conformational exchange in macromols. Rotations about dihedral angles that are slower than the global correlation time tc cause a modulation of the isotropic chem. shifts of the nuclei. If ...
We present a theoretical framework for the use of continuously phase modulated radio-frequency pulses for homonuclear decoupling in solid-state NMR. Within this framework, we have derived new families of decoupling sequences using numerical optimization. O ...
The temp. dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 ...
A novel demodulation technique for performing dynamic deformation measurements using a path-unbalanced Michelson interferometer is reported, The method is based on the rf amplitude modulation of a low-coherence source, and demodulation Is achieved by track ...
In this paper, we present new dynamic features derived from the modulation spectrum of the cepstral traje ctories of the speech signal. Cepstral trajectories are projected over the basis of sines and cosines yie lding the cepstral modulation frequency resp ...
In this paper, we present new dynamic features derived from the modulation spectrum of the cepstral traje ctories of the speech signal. Cepstral trajectories are projected over the basis of sines and cosines yie lding the cepstral modulation frequency resp ...
In the first part of the paper, also in this issue of the JOURNAL, the design of the frequency synthesizer and receiver section of an FSK transceiver was described. It operates in the 434-MHz ISM (Industrial, Scientific, Medical) band and is realized in a ...
An all-fiber phase modulator based on lead titanate zirconate coating deposited by dc reactive magnetron sputtering was fabricated and optically characterized. The frequency response showed a flat broadband structure up to 600 kHz, with an efficiency of 0. ...