Statistical Study of the Unfolding of Multimodular Proteins and their Energy Landscape by Atomic Force Microscopy
Graph Chatbot
Chattez avec Graph Search
Posez n’importe quelle question sur les cours, conférences, exercices, recherches, actualités, etc. de l’EPFL ou essayez les exemples de questions ci-dessous.
AVERTISSEMENT : Le chatbot Graph n'est pas programmé pour fournir des réponses explicites ou catégoriques à vos questions. Il transforme plutôt vos questions en demandes API qui sont distribuées aux différents services informatiques officiellement administrés par l'EPFL. Son but est uniquement de collecter et de recommander des références pertinentes à des contenus que vous pouvez explorer pour vous aider à répondre à vos questions.
The structure of a crystal of Sr0.61Ba0.39Nb2O6 has been solved and refined as an incommensurate structure in five-dimensional superspace. The structure is tetragonal, superspace group P4bm(pp1/2; p-p1/2), unit-cell parameters a = 12.4566 (9), c = 7.8698 ( ...
A theoretical model of wavelength modulation spectroscopy that uses a laser diode on a Lorentzian absorption line is presented. This theory describes the general case of a current-modulated semiconductor laser for which a combined intensity and frequency m ...
A new femtosecond pump-probe spectroscopy technique is demonstrated that permits the high-speed, parallel acquisition of pump-probe measurements at multiple wavelengths. This is made possible by use of a novel, two-dimensional smart pixel detector array th ...
In this paper, we present new dynamic features derived from the modulation spectrum of the cepstral traje ctories of the speech signal. Cepstral trajectories are projected over the basis of sines and cosines yie lding the cepstral modulation frequency resp ...
An experimental investigation on Francis turbines suffering from inlet cavitation erosion on the runner blades has permitted to assess several aspects of the actual cavitation erosion detection and prediction methods based on vibrations. Detection tests in ...
International Association For Hydraulic Research2002
A novel demodulation technique for performing dynamic deformation measurements using a path-unbalanced Michelson interferometer is reported, The method is based on the rf amplitude modulation of a low-coherence source, and demodulation Is achieved by track ...
For a general class of constant-energy trellis-coded modulation schemes with 2ν states, necessary and sufficient conditions to guarantee that a maximum-likelihood sequence estimator can decode each symbol with a fixed delay of ν symbols are deri ...
Infrared spectroscopy using semiconductor lasers is a promising technique for trace gas detection. It allows a continuous and real time monitoring of several species, with a high sensitivity and a good selectivity. Among all the possible methods two are pa ...
Linewidths, unimolecular dissociation rates and product state distributions (PSDs) have been measured for single rovibratational states of the nu(1)=5-7 levels of gas-phase trans-nitrous acid (HONO) by double-resonance overtone photofragment spectroscopy ( ...
The temp. dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 ...
