Triple Quantum Decoherence under Multiple Refocusing: Slow Correlated Chemical Shift Modulations of C' and N Nuclei in Proteins
Publications associées (33)
Graph Chatbot
Chattez avec Graph Search
Posez n’importe quelle question sur les cours, conférences, exercices, recherches, actualités, etc. de l’EPFL ou essayez les exemples de questions ci-dessous.
AVERTISSEMENT : Le chatbot Graph n'est pas programmé pour fournir des réponses explicites ou catégoriques à vos questions. Il transforme plutôt vos questions en demandes API qui sont distribuées aux différents services informatiques officiellement administrés par l'EPFL. Son but est uniquement de collecter et de recommander des références pertinentes à des contenus que vous pouvez explorer pour vous aider à répondre à vos questions.
A pulsed field gradient NMR (= nuclear magnetic resonance) method using stimulated echoes for determining the translational isotropic or anisotropic diffusion coefficient of a molecule or supramolecular assembly or the flow rate and direction of fluids con ...
A novel NMR method characterizes slow motions in proteins by multiple refocusing of double- and zero-quantum coherences of amide protons and nitrogen-15 nuclei. If both nuclei experience changes in their isotropic chem. shifts because of internal motions o ...
Infrared spectroscopy using semiconductor lasers is a promising technique for trace gas detection. It allows a continuous and real time monitoring of several species, with a high sensitivity and a good selectivity. Among all the possible methods two are pa ...
The adiabatic approximation is used to describe the electron states of weakly-one-dimensional quantum wires. A clear order is evidenced in the longitudinal optical (LO) phonon mediated transition rates with respect to the quantum numbers of the confined st ...
In scalar-coupled spin systems where in-phase and antiphase coherences have different lifetimes, the envelopes of spin echoes may feature modulations that are induced by relaxation. These modulations are most pronounced when the couplings that lead to the ...
An experimental method is presented for characterization of the combined intensity and frequency modulation produced when the injection current of a laser diode is modulated. The reported technique is based on the analysis of the harmonic signals produced ...
A novel NMR expt. allows one to characterize slow motion in macromols. The method exploits the fact that motions, such as rotation about dihedral angles, induce correlated fluctuations of the isotropic chem. shifts of the nuclei in the vicinity. The relaxa ...
The temp. dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 ...
We present a theoretical framework for the use of continuously phase modulated radio-frequency pulses for homonuclear decoupling in solid-state NMR. Within this framework, we have derived new families of decoupling sequences using numerical optimization. O ...
The electron states of weakly-one-dimensional quantum wires are computed using the adiabatic approximation in the framework of the k . p theory and the envelope-function approximation. The computed transition rates of electrons from one confined state to a ...