Concept

Social mobility

Related publications (159)

High electron mobility lattice-matched AlInN/GaN field-effect transistor heterostructures

Nicolas Grandjean, Jean-François Carlin, Eric Feltin, Marcel Py, Marcus Gonschorek

Room temperature electron mobility of 1170 cm(2)/V s is obtained in an undoped, lattice-matched, Al0.82In0.18N/GaN field-effect transistor heterostructure, while keeping a high (2.6 +/- 0.3)x10(13) cm(-2) electron gas density intrinsic to the Al0.82In0.18N ...

2006

Motility: Mobility as capital

Vincent Kaufmann

Social and territorial structures form intricate relations that transcend a social stratification or spatial focus. Territorial features and geographic displacements are structuring principles for society, as societal features and social change effect the ...

2004

The Effect of Mobility on Cooperation in Ad Hoc Networks

Jean-Pierre Hubaux, Mark Felegyhazi, Levente Buttyan

Ad hoc networks are expected to be used in many different situations. A common characteristic among these situations is that the nodes have to cooperate with each other. This problem is particularly crucial, if each node is its own authority. Reckoning the ...

2004

Last Encounter Routing under Random Waypoint Mobility

Matthias Grossglauser, Natasa Sarafijanovic-Djukic

Last Encounter Routing (LER) algorithms for mobile ad hoc networks rely only on encounter histories at every node to route packets, and therefore do not need control traffic to track topology changes due to node mobility. LER exploits the fact that past in ...

2004

Virtual Round Table on ten leading questions for network research

Paolo De Los Rios

The following discussion is an edited summary of the public debate started during the conference "Growing Networks and Graphs in Statistical Physics, Finance, Biology and Social Systems" held in Rome in September 2003. Drafts documents were circulated elec ...

Springer Verlag2004

Supporting Mobility in Content-Based Publish/Subscribe Middleware

Felix Gaertner

Publish/subscribe (pub/sub) is considered a valuable middleware architecture that proliferates loose coupling and leverages reconfigurability and evolution. Up to now, existing pub/sub middleware was optimized for static systems where users as well as the ...

2003

A new NMR method for the study of local mobility in solids and application to hydration of biopolymers in plant cell walls

David Lyndon Emsley

A new solid-state NMR experiment, J-WISE, is presented for studying local mobility in solids with atomic resolution. The experiment correlates the wide-line proton spectrum with the isotropic chemical shift of carbon-13 via the J coupling between both nucl ...

AMER CHEMICAL SOC2002

Temperature dependence of internucleotide nitrogen-nitrogen scalar couplings in RNA

Geoffrey Bodenhausen, Dominique Früh

The temp. dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 ...

2002

Dynamic models for managing durables using a stratified approach: the case of Tunja, Colombia

Claudia Rebeca Binder Signer

In this paper, dynamic models for managing durables are applied for the first time to an urban region in developing countries, i.e., Tunja in Colombia. The focus lies on the analysis of the material balance of furniture, as an example, in private household ...

Elsevier2001

The role of carrier mobility in holographic recording in LiNbO3

Demetri Psaltis

We investigate the role of carrier mobility in holographic recording in LiNbO3 crystals. Both normal holographic recording (single wavelength, single trap) and two-center recording are considered, and the differences between the performances of the two met ...

2001

Graph Chatbot

Chat with Graph Search

Ask any question about EPFL courses, lectures, exercises, research, news, etc. or try the example questions below.

DISCLAIMER: The Graph Chatbot is not programmed to provide explicit or categorical answers to your questions. Rather, it transforms your questions into API requests that are distributed across the various IT services officially administered by EPFL. Its purpose is solely to collect and recommend relevant references to content that you can explore to help you answer your questions.