Ask any question about EPFL courses, lectures, exercises, research, news, etc. or try the example questions below.
DISCLAIMER: The Graph Chatbot is not programmed to provide explicit or categorical answers to your questions. Rather, it transforms your questions into API requests that are distributed across the various IT services officially administered by EPFL. Its purpose is solely to collect and recommend relevant references to content that you can explore to help you answer your questions.
Several methods to address aromaticity in terms of nucleus-independent chem. shifts (NICS) are compared. These include NICS at the ring center NICS(0), NICS 1 .ANG. above the ring plane NICS(1), arom. ring current shielding (ARCS), and dissected NICS, i.e. ...
This paper presents a new Procedural Analog Design tool called PAD. It is a chart-based design environment dedicated to the design of analog circuits aiming to optimise design and quality by finding good tradeoffs. This interactive tool allows step-by-step ...
A new cytological tool, based on the micro Coulter particle counter (CPC) principle, aimed at diagnostic applications for cell counting and separation in haematology, oncology or toxicology is described. The device measures the spectral impedance of indivi ...
The differential pair is one of the basic amplifying stages in amplifier design. Aiming at the the design of low-distortion amplifiers, a simple model for a differential pair is derived using the Volterra series. The parameters in this model correspond to ...
We present in this paper experimental results obtained at the International Center for Lightning Research and Testing (ICLRT), Camp Blanding, Florida, where currents induced by triggered and natural lightning events were measured at one end of a shielded b ...
A new method for selective excitation in biomol. NMR uses two-fold single-transition cross-polarization between protons and nitrogen-15 or carbon-13 nuclei. Switching the frequencies between the forward and backward transfer steps allows one to select a mu ...
For the first time this paper presents strip lines fabricated using SU-8 as the dielectric material. It shows the complete fabrication process of micromachined strip lines with a total height of 35.5 um as well as their characterization by on-wafer S-param ...
Extended Kalman filtering techniques have been successfully used as sensorless control schemes on many different types of synchronous motors. One big disadvantage of the extended Kalman filtering technique is the large computational cost. Even with today's ...
In Se.C.R.E.T.S. (Segregated Copper Ratio Experiments on Transient Stability), the stability performance under transverse field transient is compared for two Nb3Sn cable-in-conduit conductors which differ only because of the different distribution of the s ...
The temp. dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 ...
