Instrumentation for real-time fluorescence lifetime imaging in endoscopy
Graph Chatbot
Chat with Graph Search
Ask any question about EPFL courses, lectures, exercises, research, news, etc. or try the example questions below.
DISCLAIMER: The Graph Chatbot is not programmed to provide explicit or categorical answers to your questions. Rather, it transforms your questions into API requests that are distributed across the various IT services officially administered by EPFL. Its purpose is solely to collect and recommend relevant references to content that you can explore to help you answer your questions.
An improved technique for chromatic dispersion measurements in single-mode fibers using phase-shift measurements is presented. The conventional experimental setup using a modulated light-emitting diode filtered by a monochromator as a light source, a fast ...
We describe a new fluorescence imaging device for clinical cancer photodetection in hollow organs in which the image contrast is derived from the fluorescence lifetime of the fluorochrome at each point in a 2D image. Lifetime images are created from a seri ...
A new method for fabricating analog Light modulators on VLSI devices is described. The process is fully compatible with devices fabricated by commercial VLSI foundries, and the assembly of the modulator structures requires a small number of simple processi ...
For a general class of constant-energy trellis-coded modulation schemes with 2 ? states, necessary and sufficient conditions to guarantee that a maximum-likelihood sequence estimator can decode each symbol with a fixed delay of ? symbols are derived. Addit ...
A novel NMR expt. allows one to characterize slow motion in macromols. The method exploits the fact that motions, such as rotation about dihedral angles, induce correlated fluctuations of the isotropic chem. shifts of the nuclei in the vicinity. The relaxa ...
An all-fiber phase modulator based on lead titanate zirconate coating deposited by dc reactive magnetron sputtering was fabricated and optically characterized. The frequency response showed a flat broadband structure up to 600 kHz, with an efficiency of 0. ...
Two all-fiber wavelength tunable devices, one utilizing thermal tuning and a second based on strain tuning, have been produced by combining resistive Ti/Pt and piezoelectric ZnO fiber coatings with fiber Bragg gratings (FBGs). The Ti and Pt coatings with t ...
The temp. dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 ...
DC-SQUIDs made of refractive materials NbN-MgO-NbN were prepared using thin film preparation techniques. The noise properties of these SQUIDs were investigated. The white energy sensitivity of typical devices is 600h (8mF0/ÃHz). The measured values are co ...
