Publications related to Linear micromirror array for broadband femtosecond pulse shaping in phase and amplitude

Optically addressing a large number of cantilevers

Jürgen Brugger, Marc Antonius Friedrich van den Boogaart

A heterodyne laser Doppler interferometer operating up to 100 MHz with an optical vibration excitation function was implemented to enable frequency detection of nanocantilevers. By using the stimulant of a network analyzer to sweep the modulation frequency ...

2003

Measurement of dynamic deformations using a path unbalance Michelson interferometer based optical fiber sensing device

Luc Thévenaz, Pramod Rastogi

A novel demodulation technique for performing dynamic deformation measurements using a path-unbalanced Michelson interferometer is reported, The method is based on the rf amplitude modulation of a low-coherence source, and demodulation Is achieved by track ...

2003

Dispersion and nonlinearity compensation by spectral phase conjugation

Demetri Psaltis

We propose the use of spectral phase conjugation to compensate for dispersion of all orders, self-phase modulation, and self-steepening of an optical pulse in a fiber. Although this method cannot compensate for loss and intrapulse Raman scattering, it is s ...

2003

High-speed femtosecond pump probe spectroscopy with a smart pixel detector array

René Salathé, Theo Lasser, Stéphane Bourquin

A new femtosecond pump-probe spectroscopy technique is demonstrated that permits the high-speed, parallel acquisition of pump-probe measurements at multiple wavelengths. This is made possible by use of a novel, two-dimensional smart pixel detector array th ...

2003

Mesure de traces de gaz à l'aide de lasers à semi-conducteur

Infrared spectroscopy using semiconductor lasers is a promising technique for trace gas detection. It allows a continuous and real time monitoring of several species, with a high sensitivity and a good selectivity. Among all the possible methods two are pa ...

EPFL2002

Bandwidth-Efficient Constant-Energy Trellis-Coded Modulation Schemes with Prescribed Decoding Delay

Bixio Rimoldi

For a general class of constant-energy trellis-coded modulation schemes with

2^{\nu}

states, necessary and sufficient conditions to guarantee that a maximum-likelihood sequence estimator can decode each symbol with a fixed delay of

\nu

symbols are deri ...

2002

Temperature dependence of internucleotide nitrogen-nitrogen scalar couplings in RNA

Geoffrey Bodenhausen, Dominique Früh

The temp. dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 ...

2002

Field Assessment of Cavitation Detection Methods in Hydropower Plants

François Avellan, Mohamed Farhat, Eduard Egusquiza

An experimental investigation on Francis turbines suffering from inlet cavitation erosion on the runner blades has permitted to assess several aspects of the actual cavitation erosion detection and prediction methods based on vibrations. Detection tests in ...

International Association For Hydraulic Research2002

Bandwidth-Efficient Constant-Energy Trellis-Coded Modulation Schemes with Prescribed Decoding Delay

Bixio Rimoldi

For a general class of constant-energy trellis-coded modulation schemes with 2 ? states, necessary and sufficient conditions to guarantee that a maximum-likelihood sequence estimator can decode each symbol with a fixed delay of ? symbols are derived. Addit ...

2001

Cross-correlated chemical shift modulation: A signature of slow internal motions in proteins

Geoffrey Bodenhausen

A novel NMR expt. allows one to characterize slow motion in macromols. The method exploits the fact that motions, such as rotation about dihedral angles, induce correlated fluctuations of the isotropic chem. shifts of the nuclei in the vicinity. The relaxa ...

2001

Linear micromirror array for broadband femtosecond pulse shaping in phase and amplitude

Graph Chatbot

Chat with Graph Search

Optically addressing a large number of cantilevers

Measurement of dynamic deformations using a path unbalance Michelson interferometer based optical fiber sensing device

Dispersion and nonlinearity compensation by spectral phase conjugation

High-speed femtosecond pump probe spectroscopy with a smart pixel detector array

Mesure de traces de gaz à l'aide de lasers à semi-conducteur

Bandwidth-Efficient Constant-Energy Trellis-Coded Modulation Schemes with Prescribed Decoding Delay

Temperature dependence of internucleotide nitrogen-nitrogen scalar couplings in RNA

Field Assessment of Cavitation Detection Methods in Hydropower Plants

Bandwidth-Efficient Constant-Energy Trellis-Coded Modulation Schemes with Prescribed Decoding Delay

Cross-correlated chemical shift modulation: A signature of slow internal motions in proteins

High-speed femtosecond pump probe spectroscopy with a smart pixel detector array

Mesure de traces de gaz à l'aide de lasers à semi-conducteur

Bandwidth-Efficient Constant-Energy Trellis-Coded Modulation Schemes with Prescribed Decoding Delay

Field Assessment of Cavitation Detection Methods in Hydropower Plants

Optically addressing a large number of cantilevers

Dispersion and nonlinearity compensation by spectral phase conjugation

Measurement of dynamic deformations using a path unbalance Michelson interferometer based optical fiber sensing device

Cross-correlated chemical shift modulation: A signature of slow internal motions in proteins

Temperature dependence of internucleotide nitrogen-nitrogen scalar couplings in RNA

Bandwidth-Efficient Constant-Energy Trellis-Coded Modulation Schemes with Prescribed Decoding Delay