Impact of self phase modulation on the performance of Brillouin distributed fibre sensors
Graph Chatbot
Chat with Graph Search
Ask any question about EPFL courses, lectures, exercises, research, news, etc. or try the example questions below.
DISCLAIMER: The Graph Chatbot is not programmed to provide explicit or categorical answers to your questions. Rather, it transforms your questions into API requests that are distributed across the various IT services officially administered by EPFL. Its purpose is solely to collect and recommend relevant references to content that you can explore to help you answer your questions.
For a general class of constant-energy trellis-coded modulation schemes with 2ν states, necessary and sufficient conditions to guarantee that a maximum-likelihood sequence estimator can decode each symbol with a fixed delay of ν symbols are deri ...
A novel demodulation technique for performing dynamic deformation measurements using a path-unbalanced Michelson interferometer is reported, The method is based on the rf amplitude modulation of a low-coherence source, and demodulation Is achieved by track ...
The temp. dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 ...
For a general class of constant-energy trellis-coded modulation schemes with 2 ? states, necessary and sufficient conditions to guarantee that a maximum-likelihood sequence estimator can decode each symbol with a fixed delay of ? symbols are derived. Addit ...
An all-fiber phase modulator based on lead titanate zirconate coating deposited by dc reactive magnetron sputtering was fabricated and optically characterized. The frequency response showed a flat broadband structure up to 600 kHz, with an efficiency of 0. ...
Infrared spectroscopy using semiconductor lasers is a promising technique for trace gas detection. It allows a continuous and real time monitoring of several species, with a high sensitivity and a good selectivity. Among all the possible methods two are pa ...
In scalar-coupled spin systems where in-phase and antiphase coherences have different lifetimes, the envelopes of spin echoes may feature modulations that are induced by relaxation. These modulations are most pronounced when the couplings that lead to the ...
A novel NMR expt. allows one to characterize slow motion in macromols. The method exploits the fact that motions, such as rotation about dihedral angles, induce correlated fluctuations of the isotropic chem. shifts of the nuclei in the vicinity. The relaxa ...
The fluorescence lifetime of living tissues is, in certain cases, related to their pathol. state and is therefore of interest for cancer detection. Measuring fluorescence lifetime in vivo during an endoscopic examn. has thus been a challenging objective fo ...
The structure of a crystal of natural melilite from San Venanzo, Umbria (Italy) of the general formula X(2)T1(T2)(2)O-7, where X = Ca0.945Sr0.005Na0.04K0.01, T1 = Mg0.92Al0.08 and T2 = Si0.99Al0.01, has been solved and refined as an incommensurate structur ...
