Publications related to Long Variable Delay and Distributed Sensing Using Stationary and Localized Brillouin Dynamic Gratings

Experimental method based on wavelength-modulation spectroscopy for the characterization of semiconductor lasers under direct modulation

An experimental method is presented for characterization of the combined intensity and frequency modulation produced when the injection current of a laser diode is modulated. The reported technique is based on the analysis of the harmonic signals produced ...

Optical Society of America2004

Correlation between modulation and structural disorder in the 4,4 '-diethoxyazoxybenzene

Gervais Chapuis, Philip Pattison

The structural refinement of the modulated phase of 4,4'-Diethoxyazoxybenzene (DXB) indicates a correlation between the shifts on the DXB molecule (modulation) and the probability to find the azoxy (N --> O) group in different configurations (disorder). Th ...

2004

On the contribution of local current density to neoclassical tearing mode stabilization

Olivier Sauter

Neoclassical tearing modes are driven by the reduction of bootstrap current inside the island due to the flattening of the pressure profile. This current perturbation enhances the magnetic perturbation responsible for the island formation. Therefore it is ...

2004

VLSI implementation of the sphere decoding algorithm

Andreas Peter Burg, Matthieu Philippe Emmanuel Zellweger

Maximum likelihood detection is an essential part of high-performance multiple-input-multiple-output (MIMO) communication systems. While it is attractive due to its superior performance (in terms of BER) its complexity using a straightforward exhaustive se ...

Ieee Service Center, 445 Hoes Lane, Po Box 1331, Piscataway, Nj 08855-1331 Usa2004

The modulated structure of Ba0.39Sr0.61Nb2O6. I. Harmonic solution

Gervais Chapuis, Alla Arakcheeva

The structure of a crystal of Sr0.61Ba0.39Nb2O6 has been solved and refined as an incommensurate structure in five-dimensional superspace. The structure is tetragonal, superspace group P4bm(pp1/2; p-p1/2), unit-cell parameters a = 12.4566 (9), c = 7.8698 ( ...

2003

Measurement of dynamic deformations using a path unbalance Michelson interferometer based optical fiber sensing device

Luc Thévenaz, Pramod Rastogi

A novel demodulation technique for performing dynamic deformation measurements using a path-unbalanced Michelson interferometer is reported, The method is based on the rf amplitude modulation of a low-coherence source, and demodulation Is achieved by track ...

2003

Bandwidth-Efficient Constant-Energy Trellis-Coded Modulation Schemes with Prescribed Decoding Delay

Bixio Rimoldi

For a general class of constant-energy trellis-coded modulation schemes with

2^{\nu}

states, necessary and sufficient conditions to guarantee that a maximum-likelihood sequence estimator can decode each symbol with a fixed delay of

\nu

symbols are deri ...

2002

Temperature dependence of internucleotide nitrogen-nitrogen scalar couplings in RNA

Geoffrey Bodenhausen, Dominique Früh

The temp. dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 ...

2002

Bandwidth-Efficient Constant-Energy Trellis-Coded Modulation Schemes with Prescribed Decoding Delay

Bixio Rimoldi

For a general class of constant-energy trellis-coded modulation schemes with 2 ? states, necessary and sufficient conditions to guarantee that a maximum-likelihood sequence estimator can decode each symbol with a fixed delay of ? symbols are derived. Addit ...

2001

Cross-correlated chemical shift modulation: A signature of slow internal motions in proteins

Geoffrey Bodenhausen

A novel NMR expt. allows one to characterize slow motion in macromols. The method exploits the fact that motions, such as rotation about dihedral angles, induce correlated fluctuations of the isotropic chem. shifts of the nuclei in the vicinity. The relaxa ...

2001

Long Variable Delay and Distributed Sensing Using Stationary and Localized Brillouin Dynamic Gratings

Graph Chatbot

Chat with Graph Search

Experimental method based on wavelength-modulation spectroscopy for the characterization of semiconductor lasers under direct modulation

Correlation between modulation and structural disorder in the 4,4 '-diethoxyazoxybenzene

On the contribution of local current density to neoclassical tearing mode stabilization

VLSI implementation of the sphere decoding algorithm

The modulated structure of Ba0.39Sr0.61Nb2O6. I. Harmonic solution

Measurement of dynamic deformations using a path unbalance Michelson interferometer based optical fiber sensing device

Bandwidth-Efficient Constant-Energy Trellis-Coded Modulation Schemes with Prescribed Decoding Delay

Temperature dependence of internucleotide nitrogen-nitrogen scalar couplings in RNA

Bandwidth-Efficient Constant-Energy Trellis-Coded Modulation Schemes with Prescribed Decoding Delay

Cross-correlated chemical shift modulation: A signature of slow internal motions in proteins

Experimental method based on wavelength-modulation spectroscopy for the characterization of semiconductor lasers under direct modulation

Correlation between modulation and structural disorder in the 4,4 '-diethoxyazoxybenzene

VLSI implementation of the sphere decoding algorithm

On the contribution of local current density to neoclassical tearing mode stabilization

The modulated structure of Ba0.39Sr0.61Nb2O6. I. Harmonic solution

Temperature dependence of internucleotide nitrogen-nitrogen scalar couplings in RNA

Measurement of dynamic deformations using a path unbalance Michelson interferometer based optical fiber sensing device

Bandwidth-Efficient Constant-Energy Trellis-Coded Modulation Schemes with Prescribed Decoding Delay

Bandwidth-Efficient Constant-Energy Trellis-Coded Modulation Schemes with Prescribed Decoding Delay

Cross-correlated chemical shift modulation: A signature of slow internal motions in proteins